Skip to main content
Home
  • Open software and databases

    Discover our world-class, open biodata resources.

    Coordination

    Find out how we bring together key partners and data in large-scale projects.

    Centre for Pathogen Bioinformatics

    At the forefront of pathogen research and surveillance

    Centre of excellence
    The comprehensive bioinformatics services we offer to unleash innovation in the life sciences.
    Biostatistics and bioinformatics analysis
    Data stewardship and management
    Knowledge representation
    Sensitive data sharing
    Software development
    Training
    Let's collaborate

    What life science data challenges can we help you solve?

    Contact us
  • Upcoming courses
    24 - 29 Aug 2025
    Summer School Machine Learning and AI
    Diest, Belgium
    25 - 27 Aug 2025
    Biodiversity bioinformatics: from large-scale phylogenomics to gene families and functions
    Lausanne
    Scientific training
    Acquire skills to make the most out of the latest advances in bioinformatics and data science.
    A group of people sitting at desks in a classroom
    Upcoming training courses
    A laptop representing the e-learning
    E-learning
    a man working at the laptop illustrating training course materials.
    Course materials
    A picture representing a lecturer and a student.
    Who do we train
    Picture representing two PhD students working together on the laptop. Job career Franziska Gruehl
    PhD Training Network
    Empty Classroom With Desks And Chairs. Lines And Dots Forming A Plexus
    Open and FAIR training
    Stay tuned

    Be the first to receive announcements of new courses.

    Leave us your email
  • Network

    We promote bioinformatics through our network across Switzerland, fostering a strong community spirit to enable innovation and collaboration.

    • How to join
    • Focus groups and other initiatives
    Publications

    Peer-reviewed articles and preprints by our scientists.

    Our groups
    Find out more about our experts both at the SIB Hub and institutions across Switzerland.
    People collaborating around a table
    Browse our groups
    Find people
    Our support functions
    Awards
    SIB Awards 2025 Banner
    Bioinformatics Awards
    SIB Remarkable Outputs 2022 Banner
    Remarkable Outputs
  • Latest outputs

    The latest scientific developments, projects and news from our scientists. Discover the in silico talks, a series of webinars by our scientists. 

     

    Browse our in silico talks

    Stay informed
    Receive the latest updates
    Impacts
    Contributions to a better future
    A butterfly representing the environment and the environmental impact of SIB.
    Environmental protection
    Close up of COVID-19 virus
    Epidemic preparedness
    A man laying on a hospital bed with a doctor
    Personalized health
    Field of wheat
    Food security
    Blue image
    Trustworthy AI
    Swiss flag with sky background
    Swiss competitiveness
    Our conferences
    BC2 Basel Computational Biology Conference
    08-11 September 2025
    Logo of the ECCB 2026 conference
    31 August - 4 September 2026
    Upcoming events
  • Flagship projects

    National platforms and secure IT networks, diagnostic tools, international projects and more.

    BioMedIT

    The national secure IT network for health-related data.

    Swiss Pathogen Surveillance Platform

    Advancing pathogen monitoring.

    About
    Find out what drives us, our mission, identity and history over the years.
    Illustration with data scientists
    Who we are
    Two bioinformaticians discussing in a lab
    Our impact
    two kids in front of a screen, participating in a game, an outreach activity for the public.
    Activities for the public
    Our organization
    Governance
    SIB Hub
    Funding sources
    Our engagements
    Working at SIB
    Environmental impact
    Equality, Diversity, Inclusion
    Browse the SIB Profile, our activity report
    Cover of the SIB Profile 2025
    Discover
  • Intranet
  • Careers
  • Contact
Search
    • English
    • Français (AT)
    • Deutsch (AT)
Home
ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG

Breadcrumb

  1. Home
  2. What's on

Latest outputs

Search

Filter by

239 results
No results
  • Photo of a woman and man holding a baby
    News

    The impact of genetic variants can depend on the parent they come from

    06 August 2025
    Traits such as height, metabolism, and disease risk can be affected differently...
  • Recon4IMD logo
    News

    A comprehensive digital map of human metabolism to improve disease treatment

    29 July 2025
    Thousands of genes, enzymes, and biochemical reactions involved in inherited...
  • Federated European Genome-phenome Archive (FEGA) logo
    News

    Switzerland joins the Federated European Genome-phenome Archive (FEGA)

    21 July 2025
    Following the successful demonstration of secure infrastructure for storing and...
  • Amos Bairoch giving a talk at the joint 33rd Intelligent Systems for Molecular Biology (ISMB) annual conference and 24th European Conference on Computational Biology (ECCB)
    News

    SIB co-founder Amos Bairoch receives prestigious bioinformatics award

    21 July 2025
    The International Society for Computational Biology (ISCB) presented Amos...
  • Swiss Pathogen Surveillance Platform (SPSP) logo
    News

    SPSP: a vital pathogen resource for public health and food safety agencies

    08 July 2025
    Representatives from Swiss and EU government agencies discussed how the Swiss...
  • Photo of Jérôme Wojcik, Chairmn of the SIN Board of Directors
    Opinion

    SIB plays a vital role in the Swiss innovation ecosystem

    04 July 2025
    With the current US science crisis, national research infrastructure like SIB is...
  • The SIB Remarkable Outputs are a shortlist of must-read or works created by SIB Members each year.
    News

    Discover the SIB Remarkable Outputs 2024

    01 July 2025
    Eight outstanding data resources, software tools, and peer-reviewed publications...
  • UniProt logo
    News

    UniProt: user benefits up to 39 times higher than operational costs

    25 June 2025
    Academic and private researchers using UniProt, a unique and high-quality...
  • Picture of Simone de Montmollin
    Opinion

    Switzerland’s opportunity to position itself as a stable and reliable player

    19 June 2025
    Science finds itself today at the heart of geopolitical turmoil. While all...
  • Portait of SIB Executive Director, Christophe Dessimoz
    Opinion

    Switzerland’s science future: continued leadership or drift into decline?

    12 June 2025
    The United States offers a cautionary tale of how a leading science nation can...
  • Logo of IMMUcan
    News

    Enabling precision oncology through a secure patient data atlas

    02 June 2025
    A unique tumour atlas will accelerate personalized cancer therapies by answering...
  • expasy swiss bioinformatics resource portal logo
    News

    ExpasyGPT: enhanced biological discovery with AI and knowledge representation

    08 May 2025
    A customized generative AI tool integrated into Expasy, the Swiss bioinformatics...
  • Logo of ELIXIR
    News

    Advancing a European initiative on biodiversity, food security and pathogens

    05 May 2025
    A strategy co-developed by SIB will guide work across 21 European countries to...
  • 3D computer-generated image of Streptococcus pneumoniae bacteria based on scanning electron microscopic imagery. Credit: Unsplash.
    News

    Antibiotic-resistant bacteria do not inevitably take over

    17 April 2025
    A comprehensive, long-term analysis of antibiotic resistance in bacteria shows...
  • a diagram showing the process of a person working on a computer.
    News

    The Swiss Personalized Health Network moves from set-up to sustainable infrastructure

    20 March 2025
    The Swiss Personalized Health Network (SPHN) facilitates the secure use and...
  • Gray and white deer on green grass during daytime
    News

    Transforming biodiversity data into conservation insights and actions

    10 March 2025
    New tools co-developed by SIB will enable near real-time monitoring of European...
  • Stick insect on a coloured background
    News

    Liberating global biodiversity knowledge from scientific literature

    04 March 2025
    SIB and other leading infrastructures and biodiversity information experts will...
  • Smart doctor hand working with modern laptop computer in modern office with virtual icon diagram
    News

    Davide Chiarugi joins SIB as Personalized Health Informatics director

    04 March 2025
    Davide Chiarugi starts this month as director of SIB’s Personalized Health...
  • Group picture of the African Bioinformatics Institute's launch
    News

    SIB contributes to launching the African Bioinformatics Institute

    27 February 2025
    The SIB executive management team participated in a preparatory conference for...
  • Image of phylogentic trees used to create the PAN-GO human gene function resource
    News

    SIB helps create most complete, accurate resource for human gene functions

    26 February 2025
    For the first time, biodata from humans have been integrated with that of other...

Data scientists for life

SIB Swiss Institute of Bioinformatics

Contact us
  • Services
    • Open software and databases
    • Centre of excellence
    • Coordination
    • Contact
  • Training
    • Upcoming training courses
    • Open and FAIR training
  • Community
    • Network
    • Awards
    • How to join SIB
    • Publications
    • Our groups
  • What's on
    • News
    • in silico talks

    • Conferences
    • Focus areas
  • About
    • Who we are
    • Flagship projects
    • Our impact
    • Activities for the public
    • Governance and organization
    • Funding sources
    • Environmental impact
    • Equality, Diversity, Inclusion
Follow us on social media

© 2025 - SIB Swiss Institute of Bioinformatics

  • Privacy policy
Search
  • English
  • Français (AT)
  • Deutsch (AT)

Services

Centre of excellence
The comprehensive bioinformatics services we offer to unleash innovation in the life sciences.
Biostatistics and bioinformatics analysis
Data stewardship and management
Knowledge representation
Sensitive data sharing
Software development
Training
Open software and databases

Discover our world-class, open biodata resources.

Coordination

Find out how we bring together key partners and data in large-scale projects.

Centre for Pathogen Bioinformatics

At the forefront of pathogen research and surveillance

Let's collaborate

What life science data challenges can we help you solve?

Contact us

Training

Scientific training
Acquire skills to make the most out of the latest advances in bioinformatics and data science.
A group of people sitting at desks in a classroom
Upcoming training courses
A laptop representing the e-learning
E-learning
a man working at the laptop illustrating training course materials.
Course materials
A picture representing a lecturer and a student.
Who do we train
Picture representing two PhD students working together on the laptop. Job career Franziska Gruehl
PhD Training Network
Empty Classroom With Desks And Chairs. Lines And Dots Forming A Plexus
Open and FAIR training
Upcoming courses
24 - 29 Aug 2025
Summer School Machine Learning and AI
Diest, Belgium
25 - 27 Aug 2025
Biodiversity bioinformatics: from large-scale phylogenomics to gene families and functions
Lausanne
Stay tuned

Be the first to receive announcements of new courses.

Leave us your email

Community

Our groups
Find out more about our experts both at the SIB Hub and institutions across Switzerland.
People collaborating around a table
Browse our groups
Find people
Our support functions
Network

We promote bioinformatics through our network across Switzerland, fostering a strong community spirit to enable innovation and collaboration.

  • How to join
  • Focus groups and other initiatives
Publications

Peer-reviewed articles and preprints by our scientists.

Awards
SIB Awards 2025 Banner
Bioinformatics Awards
SIB Remarkable Outputs 2022 Banner
Remarkable Outputs

What's on

Impacts
Contributions to a better future
A butterfly representing the environment and the environmental impact of SIB.
Environmental protection
Close up of COVID-19 virus
Epidemic preparedness
A man laying on a hospital bed with a doctor
Personalized health
Field of wheat
Food security
Blue image
Trustworthy AI
Swiss flag with sky background
Swiss competitiveness
Latest outputs

The latest scientific developments, projects and news from our scientists. Discover the in silico talks, a series of webinars by our scientists. 

 

Browse our in silico talks

Stay informed
Receive the latest updates
Our conferences
BC2 Basel Computational Biology Conference
08-11 September 2025
Logo of the ECCB 2026 conference
31 August - 4 September 2026
Upcoming events

About

About
Find out what drives us, our mission, identity and history over the years.
Illustration with data scientists
Who we are
Two bioinformaticians discussing in a lab
Our impact
two kids in front of a screen, participating in a game, an outreach activity for the public.
Activities for the public
Our organization
Governance
SIB Hub
Funding sources
Our engagements
Working at SIB
Environmental impact
Equality, Diversity, Inclusion
Flagship projects

National platforms and secure IT networks, diagnostic tools, international projects and more.

BioMedIT

The national secure IT network for health-related data.

Swiss Pathogen Surveillance Platform

Advancing pathogen monitoring.

Browse the SIB Profile, our activity report
Cover of the SIB Profile 2025
Discover
  • Intranet
  • Careers
  • Contact